Review





Similar Products

86
Synthego Inc grna sgrna sequences flanking ugp2 exon 2
Grna Sgrna Sequences Flanking Ugp2 Exon 2, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/grna-2+sequence/pm40769148-755-20-30?v=Synthego+Inc
Average 86 stars, based on 1 article reviews
grna sgrna sequences flanking ugp2 exon 2 - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier

86
Synthego Inc single grna sgrna sequences flanking ugp2 exon 2
Single Grna Sgrna Sequences Flanking Ugp2 Exon 2, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/grna-2+sequence/pmc12393875-550-0-11?v=Synthego+Inc
Average 86 stars, based on 1 article reviews
single grna sgrna sequences flanking ugp2 exon 2 - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier

90
Illumina Inc illumina sequenced grna-2
Illumina Sequenced Grna 2, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/grna-2+sequence/pmc11514453-331-17-17?v=Illumina+Inc
Average 90 stars, based on 1 article reviews
illumina sequenced grna-2 - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

93
Addgene inc cloning gene specific guide rna sequences
Cloning Gene Specific Guide Rna Sequences, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/grna-2+sequence/pmc11494886-326-6-16?v=Addgene+inc
Average 93 stars, based on 1 article reviews
cloning gene specific guide rna sequences - by Bioz Stars, 2026-06
93/100 stars
  Buy from Supplier

92
Santa Cruz Biotechnology guide rna grna sequences
Guide Rna Grna Sequences, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/grna-2+sequence/pm38582251-71-9-6?v=Santa+Cruz+Biotechnology
Average 92 stars, based on 1 article reviews
guide rna grna sequences - by Bioz Stars, 2026-06
92/100 stars
  Buy from Supplier

90
Synthego Inc grna sequence 2

Grna Sequence 2, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/grna-2+sequence/pmc10694670-100-0-5?v=Synthego+Inc
Average 90 stars, based on 1 article reviews
grna sequence 2 - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
GenScript corporation grna-2 sequence

Grna 2 Sequence, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/grna-2+sequence/us11643672-456-2-22?v=GenScript+corporation
Average 90 stars, based on 1 article reviews
grna-2 sequence - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
Biotechnology Information nucleotide sequence of the omicron variant (b.1.1.529) of the sars-cov-2 grna

Nucleotide Sequence Of The Omicron Variant (B.1.1.529) Of The Sars Cov 2 Grna, supplied by Biotechnology Information, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/grna-2+sequence/pm37185717-67-11-21?v=Biotechnology+Information
Average 90 stars, based on 1 article reviews
nucleotide sequence of the omicron variant (b.1.1.529) of the sars-cov-2 grna - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
KU Leuven p58 backbone with 2 grna targeting sequence for pdc1
Plasmids used in this work
P58 Backbone With 2 Grna Targeting Sequence For Pdc1, supplied by KU Leuven, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/grna-2+sequence/pmc09520875-21-2-16?v=KU+Leuven
Average 90 stars, based on 1 article reviews
p58 backbone with 2 grna targeting sequence for pdc1 - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
KU Leuven p58 backbone with 2 grna targeting sequence for pdc5
Plasmids used in this work
P58 Backbone With 2 Grna Targeting Sequence For Pdc5, supplied by KU Leuven, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/grna-2+sequence/pmc09520875-22-0-16?v=KU+Leuven
Average 90 stars, based on 1 article reviews
p58 backbone with 2 grna targeting sequence for pdc5 - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

Image Search Results


Journal: iScience

Article Title: TIGIT contributes to the regulation of 4-1BB and does not define NK cell dysfunction in glioblastoma

doi: 10.1016/j.isci.2023.108353

Figure Lengend Snippet:

Article Snippet: gRNA sequence 2: AUGUCACCUCUCCUCCACCA , Synthego , N/A.

Techniques: Recombinant, Lactate Dehydrogenase Assay, Cell Based Assay, Gene Knockout, Enzyme-linked Immunosorbent Assay, shRNA, Sequencing, Software, Gene Expression

Plasmids used in this work

Journal: Microbial Cell Factories

Article Title: Development of an industrial yeast strain for efficient production of 2,3-butanediol

doi: 10.1186/s12934-022-01924-z

Figure Lengend Snippet: Plasmids used in this work

Article Snippet: P58-PDC1 , P58 backbone with 2 gRNA targeting sequence for PDC1 (AGCATCCAACAATTTTTGCA and GATAAGCTTTATGAAGTCAA) , MCB, KU Leuven.

Techniques: Marker, Plasmid Preparation, Sequencing, Expressing